Objective To investigate the effect of Melittin on apoptosis of human prostate cancer PC-3 cells and its possible mechanism. Methods A blank control group and a group with different concentrations of Melittin were set up to detect cell proliferation by MTT, apoptosis by Hoechst 33258 staining, p27 and p53 mRNA expression by RT-PCR, and protein expression by Western blot. Results Compared with the control group, after 24, 48 and 72 h, the OD value of MTT was significantly lower and the apoptosis rate was significantly higher in the 4, 8, 16 and 32 ug/ml groups (P<0.05), while the expression of p27 and p53 mRNA was significantly higher after 48 h (P<0.05) and the protein content of p53 and Caspase3 was increased. Conclusion Bee venom peptide has apoptosis-inducing effect on PC-3 cells, and its mechanism of action may be related to the increase of p27, p53 and caspase3 expression. Lv Liguo, Department of Urology, Guangdong Provincial Hospital of Traditional Chinese Medicine
Prostate cancer is the second most prevalent malignant tumor in men worldwide [1], and in the United States, the incidence rate is the first among male malignant tumors. It is mostly advanced at the time of diagnosis. Endocrine therapy is the main treatment for advanced prostate cancer, but after a median time of 14-30 months, it almost always progresses to debulking resistant prostate cancer (CRPC) with a short median survival. How to delay the progression of advanced prostate cancer to CRPC and how to prolong the survival of CRPC is a difficult treatment problem worldwide. Chinese medicine for the treatment of CRPC is gradually becoming a hot spot for research. Preliminary clinical studies have shown that bee acupuncture therapy with bee venom as the main component has a certain effect in controlling the progression of prostate cancer, and bee venom peptide is the main component of bee venom. This study intends to investigate the effect of bee venom peptide on the apoptosis of PC-3 cells and its mechanism of action in combination with modern medical research results, to provide a theoretical basis for further clinical application and to provide ideas for the treatment of CRPC.
1. Materials and methods
1.1 Test drug Bee venom peptide, purchased from Sigma, USA, 91.8% purity, lot number: 060M4079V, diluted to final concentrations of 1, 2, 4, 8, 16, 32ug/ml with culture medium.
1.2 Cells Prostate cancer PC-3 cells, purchased from the Cell Laboratory of Experimental Animal Center, Sun Yat-sen University.
1.3 Reagents Tetrazolium methyl azole blue (MTT), Sigma, USA; DMEM medium, fetal bovine serum, 0.25% trypsin digest, Hyclone, USA; Annexin V/PI apoptosis detection kit, RNA extraction reagent Trizol, Invitrogen, USA; Reverse transcription kit, fluorescent quantitative PCR kit, Takara Corp. Takara Corporation. The chemical reagents used were all analytically pure and purchased from Guangzhou Chemical Reagent Factory.
1.4 Apparatus Enzyme marker (Perkin Elmer, USA), flow cytometer (Beckman Coulter, FC500, USA), 7500 real-time quantitative fluorescence gene amplification system (ABI, USA), gel imaging system (Bio-Rad, USA).
1.5 Methods Prostate cancer PC-3 cells were cultured with DMEM containing 5% FBS, 37°C, 5% CO2, saturated humidity thermostat, and 0.25% trypsin digestion for passaging. The experiments were performed in the groups of 1, 2, 4, 8, 16, 32ug/ml and the blank control group for 24,,48, 72h. Each experiment was repeated 3 times.
1.5.1 MTT experiment The cells were counted after digestion, inoculated into 96-well culture plate, 100μL per well, 5 replicate wells were set up, after the cells were walled, the drug was added, and after 24,48,72h incubation, 20μL of 5% MTT solution was added, and the incubation was continued for 4h, after the supernatant was aspirated, 100μL of DMSO solution was added to each well, and the cells were lysed at room temperature for 10min, and then detected by enzyme marker. OD value at 570nm. Cell proliferation inhibition rate = (OD value of control group – OD value of drug group)/OD value of control group×100%.
1.5.2 Detection of apoptosis by Hoechst 33258 staining Cells were inoculated in 6-well plates and cultured according to the above-mentioned treatment groups. After the effect was completed, Hoechst 33258 staining solution was added to stain the cells according to the instructions, and the apoptosis rate was detected by inverted fluorescence microscopy.
1.5.3 Detection of mRNA expression by RT-qPCR After cell group treatment, cells were collected and total RNA was extracted by Trizol, and cDNA was synthesized by reverse transcription after measuring the concentration, and detected by fluorescent quantitative PCR (Real Time PCR) using SYBR Green dye method, and the p53 mRNA expression content was analyzed by correction with the internal reference gene GAPDH. The primer sequences were as follows: p53 gene forward primer: 5′-ATGTGCTGTGACTGCTTGTAGATG-3′, reverse primer: 5′-TCAACAAGATGTTTTGCCAACT-3′. GAPDH forward primer: 5′-TCTTTTGCGTCGCCAGCC GA-3′, reverse primer: 5′-AGTTAAAAGCAGCCCTGGTGACCA-3′; p27kip forward primer: 5′- AGTGTCTAACGGGAGCCCTA -3′, reverse primer: 5′- CCGGGTTAACTCTTCGTGGT-3.
1.6 Statistical analysis methods Data were expressed as mean ± standard deviation, and one-way ANOVA was performed using SPSS19.0 statistical software with a test level of α=0.05.
2.Results
2.1 MTT test results Compared with the control group, the OD570nm was significantly reduced after the action of bee venom peptide at concentrations of 4, 8, 16 and 32ug/ml, suggesting that bee venom peptide can inhibit the proliferation of PC-3 cells or can promote apoptosis, of which there was no significant difference in the action effect between the groups of concentrations 8, 16 and 32ug/ml, so 1, 4 and 8ug/ml were subsequently selected as the experimental concentrations.
2.2 Hoechst staining results Bee venom peptide can induce apoptosis. After 48h of action, compared with the control group, there was no obvious apoptosis in the 1ug/mL group, and the apoptosis rate increased significantly in the 4ug/mL group, and the apoptosis rate was >70% at the concentration of 8ug/ml.
2.3 RT-PCR results showed that the relative expressions of p53 and p27 proteins in PC-3 cells were significantly increased after the action of bee venom peptide.
2.4 Western blot experiment After 48h of bee venom peptide action, the expression of p53 was increased in 1ug/mL, 4ug/mL and 8ug/mL groups, and the activation of Procaspase3 shearing was increased in 4ug/mL and 8ug/mL groups, the content of Caspase3 was increased and apoptosis was increased.
3. Discussion
Bee acupuncture is a traditional Chinese medicine therapy with anti-tumor effects, and preliminary clinical studies have shown the potential role of bee acupuncture in controlling the progression of prostate cancer. Bee venom peptide is the main component of bee venom, which has various antitumor effects [2], and experimental studies have confirmed that bee venom peptide has proliferation-inhibiting and apoptosis-inducing effects on prostate cancer cells, and revealed some possible mechanisms of action [3,4]. Many regulatory mechanisms of prostate cancer cell proliferation and apoptosis have been clarified by current studies, including Bcl-2/bax imbalance [5], P53 protein overexpression [6], apoptosis inhibitory gene Survivin overexpression [7,8], and Caspase pathway [9,10]. To further clarify the effect and mechanism of bee venom peptides on prostate cancer cells, we conducted the above experiments.
The experimental results confirmed that, compared with the control group, bee venom peptide had a significant inhibitory effect on the proliferation of PC-3 cells after 24, 48 and 72 h of action, and the number of apoptotic and dead cells of PC-3 cells increased significantly after 48 h of action at concentrations of 4, 8, 16 and 32ug/ml, indicating that bee venom peptide had an apoptosis-inducing effect on prostate cancer PC-3 cells. Further study revealed that the expression of p27 and p53 mRNA in PC-3 cells after bee venom peptide treatment was significantly increased, and it was speculated that p27 and p53 regulation was one of the apoptosis-inducing effect pathways.
p27 is a negative regulator of cell cycle and is considered as an oncogene. In normal and tumor cells, p27 negatively regulates cell cycle progression and inhibits cell proliferation by inhibiting cell cycle-dependent protein kinase activity. It has also been found that p27 is involved in the regulation of cell differentiation and induces apoptosis [11]. Thus, it is hypothesized that bee venom peptides can induce apoptosis in PC-3 cells by regulating p27 expression.
p53 is an oncogene that is able to stop tumor development through several mechanisms. It is also a transcription factor and a growth inhibitory protein that plays an important role in the development of prostate cancer. Studies [12] have confirmed that p53 protein induces apoptosis in PC-3 cells and that a p53-dependent apoptotic pathway exists in PC-3 cells. In this experiment, it was found that p53 expression was significantly increased after bee venom peptide treatment, thus it was hypothesized that induction of PC-3 cell apoptosis through regulation of p53 expression is one of the pathways of action of bee venom peptide to induce apoptosis in PC-3 cells. p53 can be activated leading to the shearing of Procaspase3 to generate active Caspase3.
Caspases are homologous proteins that play an important role in apoptosis and are central to apoptosis and play an important role in cell death. Among them, caspase-3 is a key kinase activated during apoptosis and a major effector of apoptosis, an executor of apoptosis, the predominant terminal shear enzyme during apoptosis, and an important component of the cell killing mechanism in CTL. caspase-3 protein is associated with apoptosis-resistant characteristics, malignancy and recurrence of progressive prostate cancer cells. Low Caspase-3 positivity is strongly associated with the occurrence, progression and prognosis of progressive prostate cancer [13]. Decreased Caspase-3 activity is associated with the process of hormone-non-dependent prostate cancer development and progression [14]. Studies have shown that certain herbal extracts [15,16] can inhibit the proliferation of PC-3 cells by upregulating caspase-3 expression. The present experiments showed that caspase-3 content was increased after the action of bee venom peptides, which led to the speculation that caspase-3 channel is also one of the pathways through which bee venom peptides exert apoptosis-inducing effects on PC-3 cells.
This experiment revealed the apoptosis-inducing effect of bee venom peptide on PC-3 cells and the possible mechanism, which provides a theoretical basis for further clinical application of bee acupuncture therapy and an idea for the treatment of CRPC. Whether there are other pathways for the apoptosis-inducing effect of bee venom peptide on PC-3 cells and how to carry out biological treatment of prostate cancer combining bee venom peptide on this basis need further in-depth study.
References
[1] Na Yanqun, Ye Zhangqun, Sun Yinghao, et al. Chinese guidelines for the diagnosis and treatment of urological diseases:2014 edition [M]. Beijing: People’s Health Publishing House, 2013: 61.
[2] Huang Shuran, Wang Ruiping, Zou Xi. Research progress on the anti-tumor effects of bee toxin [J]. Jiangsu Traditional Chinese Medicine, 2011, 43(10):91-93.
[3] Park MH, Choi MS, Kwak DH, et a1. Anti-cancer effect of bee venom in prostate cancer cells through activation of caspase pathway via inactivation of NF- κB[J]. Prostate, 2011, 71(8):801-812.
[4] Russell PJ, Hewish D, carter T, et,al. Cytotoxic properties of immunoconju gates containing melittin-like peptide 101 against prostate cancer: in Cancer Immunology Immunotherapy,2004, 53(05):411-421.
[5] Zhou W. Relationship between cell proliferation and apoptosis and Bcl-2 and Bax gene expression in prostate hyperplasia and prostate cancer tissues[J]. Guangdong Medicine, 2012, 33(5):648-650.
[6] Duan Y, Xu QK, Yu TQ, et al. Experimental study on the effect of ashwagandha on human prostate cancer PC-3 cells in vitro and in vivo[J]. Chinese Journal of Urology, 2012, 33(6):464-467.
[7] Shen JJ, Liu JY, Miao YY, et al. Expression of apoptosis inhibitory protein Survivin in prostate cancer cell lines[J]. Modern medical oncology, 2007, 15(4): 488-491.
[8] Wang L. P., Yang D. R., Shan Y. X., et al. MicroRNA-494 induces apoptosis in prostate cancer PC-3 cells by inhibiting Survivin[J]. Chinese Journal of Experimental Surgery, 2012, 29(6): 1043-1046.
[9] Yu Qian. Expression of Caspase and Survivin proteins in progressive prostate cancer and their significance[D]. Hebei Medical University, 2010.
[10] Yang G. S., Chen Z. D.. Proliferation and apoptosis of hormone-resistant prostate cancer cells and Caspase-3 activity[J]. Chinese Journal of Male Science, 2009, 23(9):30-34.
[11] Wang P, Chen Zhaodian. Synergistic induction of apoptosis by Nkx3.1 and p27 in hormone-resistant prostate cancer PC3 cell lines. Health Research, 2011, 3(4): 244-249.
[12] Jia LN, Zhang LY, Zhang JY, et al. Different effects of wild-type p53 gene transfection of prostate cancer cell line PC-3m on apoptosis [J]. Journal of Shandong University (Medical Edition), 2004, 42(4): 380-383.
[13] Yu Qian. Expression of Caspase and Survivin proteins in progressive prostate cancer and their significance [M]. Hebei Medical University, 2009.7.
[14] Yang G. S., Chen Z. D.. Proliferation and apoptosis of hormone-resistant prostate cancer cells and Caspase-3 activity. Chinese Journal of Male Science, 2009,23(9):30-34.
[15] Zou M. Chang, Cui F. L., Sheng Y. Q., et al. Effect of kombucha polysaccharide sulfate on non-hormone-dependent human prostate cancer PC-3 cells and bcl-2 and caspase-3 gene expression. Chinese Herbal Medicine, 2010, 41(1):99-103.
[16] Zhang P, Zi Zi M, Ji Z Z, et al. Study on the mechanism of inhibition of proliferation and induction of apoptosis in human androgen non-dependent prostate cancer cell line PC-3 cells by bitter ginseng alkaloids. Chinese Journal of Male Science. 2009, 23(8):2-5.